Publique en esta revista
Información de la revista
Vol. 56. Núm. 8.
Páginas 751-832 (Agosto 2003)
Compartir
Compartir
Descargar PDF
Más opciones de artículo
Vol. 56. Núm. 8.
Páginas 751-832 (Agosto 2003)
DOI: 10.1157/13050330
Acceso a texto completo
Diferencias en la presentación clínica en sujetos con fenotipo de hipercolesterolemia familiar por defectos en el receptor LDL y por defectos de la apo B-100
Differences in clinical presentation between subjects with a phenotype of familial hypercholesterolemia determined by defects in the LDL-receptor and defects in Apo B-100
Visitas
13632
Ignacio García-Álvareza, Sergio Castillob, Pilar Mozasb, Diego Tejedorb, Gilberto Reyesb, Marta Artiedaa, Ana Cenarroa, Rodrigo Alonsoc, Pedro Matac, Miguel Pocovib, Fernando Civeiraa
a Departamentos de Medicina y Psiquiatr??a. Hospital Universitario Miguel Servet. Zaragoza. Espa??a.
b Departamentos de Bioqu??mica, Biolog??a Molecular y Celular de la Universidad de Zaragoza. Zaragoza. Espa??a.
c Unidad de L??pidos. Fundaci??n Jim??nez D??az. Madrid. Espa??a.
Este artículo ha recibido
13632
Visitas
Información del artículo
Estadísticas
Tablas (4)
TABLA 1. Puntuación MED PED para el diagnóstico de la hipercolesterolemia familiar
TABLA 2. Criterios de clasificación MED PED para el diagnóstico de la hipercolesterolemia familiar
TABLA 3. Comparación de variables cuantitativas estudiadas en los sujetos HF y BDF
TABLA 4. Variables cualitativas: frecuencias relativas y valor de p en la prueba de ?2 entre BDF y HF
Mostrar másMostrar menos
Introducción y objetivos. La hipercolesterolemia familiar y la apo B-100 defectuosa familiar resultan fenotípicamente indistinguibles. Hoy día es posible diferenciarlas mediante la realización de un análisis genético. Pacientes y método. Comparamos las características clínicas de 13 sujetos con apo B-100 defectuosa familiar y 39 sujetos con hipercolesterolemia familiar. Para comparar la morbimortalidad de ambos grupos utilizamos datos de sus familiares de primer grado. Resultados. Observamos diferencias significativas en los valores de colesterol total (CT) y colesterol unido a lipoproteínas de baja densidad (cLDL) de los sujetos afectados, que fueron menores en el grupo de apo B 100 defectuosa familiar (CT 357 ± 37,3 frente a 415 ± 79,7 mg/dl; y cLDL 270 ± 34,2 frente a 355 ± 72,4 mg/dl). No observamos diferencias en cuanto a la presencia de xantomas, arco corneal, hábito tabáquico, episodio vascular, presión arterial, índice de masa corporal (IMC) e índice cintura/cadera. No hubo diferencias significativas en cuanto a las proporciones de fallecidos y afectados de enfermedad cardiovascular de uno y otro grupo. La diferencia de medias de edad alcanzada sin enfermedad cardiovascular (45,3 ± 19,9 años en la hipercolesterolemia familiar y familiares, y 51,5 ± 20,8 años en la apo B100 defectuosa familiar y familiares) resultó significativa (p = 0,023). Conclusiones. La apo B-100 defectuosa familiar produce una hipercolesterolemia clínicamente más benigna que la hipercolesterolemia familiar, por lo que su diferenciación puede ayudar a estratificar el riesgo en los sujetos con estas hipercolesterolemias hereditarias.
Palabras clave:
Hipercolesterolemia
Lipoproteínas de baja densidad
Genética
Introduction and objectives. Familial hypercholesterolemia and familial defective Apo B-100 are phenotypically indistinguishable. At present they can be distinguished by genetic analysis. Patientes and method. We compared the clinical features of 13 subjects with familial defective Apo B-100 and 39 subjects with familial hypercholesterolemia. We used data from first degree relatives to compare morbidity and mortality between the two groups. Results. We found statistically significant differences in total cholesterol and LDL cholesterol, which were lower in the familial defective Apo B-100 group (TC = 357 ± 37.3 mg/dl vs 415 ± 79.7 mg/dl and LDLc = 270 ± 34.2 mg/dl vs 355 ± 72.4 mg/dl). We found no differences in xanthomas, corneal arcus, smoking status, vascular events, blood pressure, BMI or waist/hip ratio. There were no differences between the two groups in the proportions of patients with cardiovascular disease or patients who died. We found statistically significant differences between the groups (p = 0.023) in the mean age at first vascular event (familial hypercholesterolemia and first degree relatives: 45.3 ± 19.9 years; familial defective Apo B-100 and first degree relatives: 51.5 ± 20.8 years). Conclusions. We conclude that familial defective Apo B-100 results in clinically milder hypercholesterolemia than familial hypercholesterolemia, and that discerning between them could be helpful to stratify the risk in persons with hereditary hypercholesterolemia.
Keywords:
Hypercholesterolemia
Low density lipoproteins
Genetics
Texto completo

INTRODUCCIÓN

Las hipercolesterolemias monogénicas son un tipo de enfermedades del metabolismo lipídico que se caracterizan por un aumento de colesterol unido a lipoproteínas de baja densidad (cLDL), transmisión autosómica dominante y una alta incidencia de enfermedad coronaria prematura1. Los dos genes mejor conocidos responsables de estos tipos de hipercolesterolemia son el del receptor LDL y el de la apolipoproteína B-100. La existencia de mutaciones en dichos genes da lugar a dos enfermedades conocidas como hipercolesterolemia familiar (HF) y apo B-100 defectuosa familiar (BDF), respectivamente.

La HF es una enfermedad autosómica codominante producida por defectos en el receptor celular de superficie de membrana, que reconoce e internaliza las lipoproteínas de baja densidad (LDL) del plasma. En 1938, Müller describió por primera vez la enfermedad como un error hereditario del metabolismo que conduce a la presencia de xantomas tendinosos, elevaciones del colesterol plasmático e infarto agudo de miocardio en pacientes jóvenes2. Más tarde, Kachadurian definió las características clínicas y genéticas de la enfermedad y diferenció los heterocigotos de los homocigotos en familias libanesas afectadas3. Goldstein y Brown4 caracterizaron el receptor de las LDL y la relación de esta enfermedad con los defectos de dicha proteína. Finalmente, en 1983, se clonó el ADN del gen5. La frecuencia de heterocigotos se estima en 1/500 en la mayoría de las poblaciones (europeas, norteamericanas y japonesa), y la frecuencia de homocigotos es de 1/1.000.0006.

La BDF fue descrita por primera vez en 1989, identificando una mutación en el codón 3.500 del gen de apo B que sustituía la arginina por glutamina (R3500Q)7. Las mutaciones localizadas alrededor del codón 3500 afectan al dominio de unión de la proteína apo B-100 con el r-LDL, con lo que se impide su reconocimiento y unión con dicho receptor y, por consiguiente, aumentan los valores plasmáticos de LDL.

El fenotipo de esta enfermedad es similar al presentado por los sujetos heterocigotos para HF, con concentraciones elevadas de cLDL, xantomas, arco corneal y cardiopatía isquémica precoz, lo que impide la diferenciación de individuos con HF y BDF por el fenotipo. Su prevalencia se estima entre 1/300 y 1/700 en poblaciones centroeuropeas8,9. En España, la prevalencia de BDF no está establecida y, posiblemente, varía entre las diferentes regiones; sin embargo, a tenor de los datos publicados10, 11 parece inferior a la prevalencia de otros países europeos.

El diagnóstico genético ha permitido una comparación más precisa entre los fenotipos de HF y BDF. Recientemente, se han encontrado diferencias entre las dos entidades, observándose un fenotipo más suave en los individuos con BDF12,13, tanto para las concentraciones lipídicas como para las manifestaciones de enfermedad cardiovascular.

El objetivo del presente trabajo es conocer si existen diferencias en la incidencia de complicaciones cardiovasculares y en el perfil lipídico en una muestra de sujetos con HF y BDF de los que se dispone de diagnóstico genético del defecto responsable.

PACIENTES Y MÉTODO

Población de referencia

Para la selección de la muestra se partió del Registro de Pacientes de la Fundación Española de la Hipercolesterolemia Familiar. En este registro se incluye a pacientes procedentes de 69 unidades clínicas, distribuidas por todo el país. Para su inclusión el paciente debe cumplir criterios clínicos de certeza de hipercolesterolemia familiar propuestos por el propio MED PED de la Organización Mundial de la Salud14 (tablas 1 y 2). Se remitieron, al laboratorio central, un cuestionario que incluía datos clínicos de la historia y la exploración del paciente, y muestras de sangre, que se enviaron en condiciones de refrigeración en menos de 24 h. Antes de empezar el estudio se mantuvieron tres reuniones con los médicos participantes con el objetivo de homogeneizar los datos, incluyendo la historia familiar, procedentes de las diferentes unidades clínicas. La relación de unidades de lípidos y las características clínicas del total de los pacientes con HF remitidos, así como sus manifestaciones de enfermedad cardiovascular, han sido ya publicadas15.

Análisis de lípidos

Se determinaron las concentraciones séricas de colesterol total y triglicéridos mediante métodos colorimétricos enzimáticos. El análisis de HDL se llevó a cabo en el sobrenadante, tras la precipitación de lipoproteínas que contienen apo B con sulfato de dextrano. El cLDL se calculó mediante la fórmula de Friedewald.

Extracción de ADN

Para la extracción del ADN genómico se empleó una muestra de 10 ml de sangre periférica mediante el equipo comercial Puregene (Isolation kit, Gentra Systems, MN EE.UU.). El ADN se diluyó en una solución de 10 mmol/l de Tris-HCl, 0,1 mmol/l de tampón EDTA, con un pH de 8,0 hasta una concentración final de 100 μg/ml.

Análisis de la mutación R3500Q

Un fragmento de 143 pares de bases del exón 26 del gen de la apolipoproteína B, que incluía el codón 3.500, se amplificó por reacción en cadena de la polimerasa (PCR) utilizando los siguientes cebadores: APOB3500D:5'CTTACTTTTCCATTGAGT AC TCTACC-3' y APOB3500R:5'AGTGCCCTGCAGCTTCACTGA GT AC-3'. Cada cebador presentó dos bases desapareadas (subrayadas) con el fin de introducir un nuevo lugar de reconocimiento para la enzima de restricción ScaI en el extremo 5' y crear en el extremo 3' un nuevo lugar de reconocimiento sólo donde la secuencia del alelo mutante estuviera presente. El lugar de restricción creado por el cebador ApoB3500D se utilizó como control de la enzima de restricción.

La PCR se realizó en un volumen final de 50 μl que contenía: 500 ng de ADN, 20 mmol/l de Tris-HCl (pH 8,4), 50 mmol/l de KCl y 1,5 mmol/l de MgCl2. Se añadió al resto de los componentes: 0,4 μmol/l de cada cebador, 0,2 mmol/l de cada dNTP y 1,5 unidades de Taq ADN polimerasa (Gibco BRL). Se realizó un ciclo inicial con una fase de desnaturalización a 94 oC de 2 min, una fase de hibridación a 55 oC de 1 min, y una fase de extensión de un minuto a 72 oC. Después, se programaron 29 ciclos como el descrito: desnaturalización (1 min a 94 oC), hibridación 1 min a 55 oC y extensión (1 min a 72 oC). Al final, se realizó un paso de extensión de 5 min a 72 oC.

Un total de 15 μl de cada muestra amplificada por PCR se digirieron con 15 unidades de ScaI (Amersham Pharmacia Biotech) en un volumen de 30 μl, de acuerdo a las instrucciones del fabricante. A continuación, se llevó a cabo una electroforesis de los fragmentos obtenidos en un gel de agarosa Nusieve (Nusieve GTG, Molecular applications. Rockland, ME, EE.UU.) durante 75 min a un voltaje constante de 90 V, manifestándose la presencia de fragmentos de 125 y 18 pares de bases en los alelos normales, y fragmentos de 125, 102 y 18 pares de bases en los alelos mutantes heterocigotos.

Selección de la muestra

La presencia de la mutación R3500Q se determinó en 967 sujetos no relacionados, con el diagnóstico clínico de certeza de hipercolesterolemia monogénica según los criterios clínicos del MED PED. Se obtuvo consentimiento informado, por escrito, de todos los sujetos participantes en el estudio.

Para comparar los sujetos BDF con sujetos HF se seleccionó a 3 sujetos HF por cada BDF mediante la aplicación de los siguientes criterios: mismo sexo y la edad ± 5 años. Siempre que fue posible se eligió un sujeto de la misma comunidad autónoma; cuando hubo más de uno, se seleccionó el de la misma provincia, y si también había varios, el de edad más próxima. Cuando ningún sujeto cumplió las tres primeras premisas, se amplió la edad de selección a ± 6 años. Cuando varios cumplían las mismas condiciones, se aleatorizó la elección.

Datos de familiares de primer grado

Con el fin de ampliar la información disponible, para estudiar la morbimortalidad del grupo incluimos en el cuestionario datos de morbimortalidad de familiares, los cuales se obtenían mediante entrevista clínica con el paciente. En dicho cuestionario se preguntaba por cada familiar de primer grado para conocer si se encontraba vivo o muerto, su edad y la presencia de antecedentes de IAM, bypass aortocoronario, angioplastia coronaria e ictus (incluida la edad a la que los habían sufrido, si era conocida). Los 13 pacientes con BDF tenían un total de 67 familiares de primer grado. Los 39 pacientes con HF tenían un total de 181 familiares de primer grado. En todos los casos se conocía si el familiar de primer grado estaba vivo o no. La edad se anotó en 60 de los 67 familiares de primer grado del grupo BDF y en 172 de los 181 familiares de primer grado del grupo HF. Se comunicaron episodios vasculares en siete de los 67 familiares de primer grado del grupo BDF y en 25 de los 181 familiares de primer grado del grupo HF.

Análisis estadístico

Para el análisis estadístico de los datos se empleó el programa informático Stat View 5.0. Para la comparación de variables cuantitativas se empleó el test de la t de Student para datos no apareados, y para la comparación de variables cualitativas dicotómicas los tests de Fisher y de la χ². Las concentraciones de lípidos empleadas en el análisis estadístico corresponden a determinaciones sin tratamiento hipolipemiante. Se denominó evento vascular a la presencia de un antecedente de IAM, angina coronaria, cirugía de revascularización coronaria, angioplastia coronaria, claudicación intermitente o ictus.

RESULTADOS

Se encontró un total de 13 sujetos portadores heterocigotos de la mutación R3500Q. Se seleccionó a 39 sujetos con HF, según los criterios de concordancia ya expuestos.

Las principales características clínicas de los sujetos con HF y BDF se describen en las tablas 3 y 4. Existe una diferencia significativa en las concentraciones de colesterol total y cLDL entre los sujetos con BDF y los que padecen HF, que es menor en los primeros. Hubo una tendencia, que no alcanzó significación estadística, hacia unas mayores concentraciones de cHDL en los sujetos con BDF. No existen diferencias en la muestra en cuanto a la prevalencia de otros rasgos fenotípicos o de otros factores de riesgo cardiovascular.

Se utilizaron los datos de los familiares de primer grado, 67 de BDF y 181 de HF, comparando la morbimortalidad de ambos grupos.

Al comparar los datos familiares, la media de edad fue mayor en los familiares de sujetos del grupo BDF (51,5 años) que en los del grupo HF (46,1 años), pero esta diferencia no resultó significativa (p = 0,051). Sí resultó significativa (p = 0,023) la diferencia en cuanto a media de edad alcanzada sin episodios vasculares, que fue de 45,3 años en los sujetos con HF y familiares, y de 51,5 años en los sujetos BDF y familiares. Las proporciones de fallecidos (17/67 BDF y 39/181 HF) y afectados de enfermedad cardiovascular (7/67BDF y 25/181HF) tampoco difirieron significativamente (p = 0,52 y p = 0,48, respectivamente) entre ambos grupos.

DISCUSIÓN

Nuestros resultados muestran un fenotipo de hipercolesterolemia más suave en la BDF que el producido por mutación en el gen del r-LDL. Dado el diseño del estudio, las conclusiones obtenidas deben limitarse a la comparación entre HF y BDF, sin que puedan ser extrapoladas a la descripción del riesgo cardiovascular de estas dos entidades en España. Sin embargo, el perfil lipídico es semejante al publicado en otros estudios de HF en España16,17.

Las observaciones reflejadas en la bibliografía muestran, sin duda alguna, que la mutación BDF es capaz, en presencia de un sustrato ambiental y genético adecuado, de dar lugar a un síndrome clínico indistinguible de una clásica HF heterocigota18. Sin embargo, dada su menor prevalencia en la población general, resulta difícil demostrar su asociación a eventos coronarios en ésta, como vemos en el estudio de Brousseau et al19, que realiza un cribado de BDF en 622 casos de infarto de miocardio y 639 sujetos control, sin encontrar diferencias en ambos grupos.

Son varios los estudios en los que se aprecia un fenotipo aparentemente más suave en el BDF, pero sin significación estadística debido al escaso número de la muestra12,13,20,21. Para ampliar el número de la muestra se ha recurrido a incluir en los estudios a familiares de primer grado de los casos índice. Hay que considerar que se trata de una muestra de pacientes relativamente jóvenes (media de edad 45 años), y que los datos solicitados se refieren a familiares muy cercanos (padres, hijos y hermanos), por lo que cabe esperar un buen grado de conocimiento de los elementos empleados en este análisis (defunción, edad, eventos vasculares), si bien, sobre todo en lo que se refiere a morbilidad, puede llevarnos a subestimar la verdadera proporción. Además, entre estos sujetos, tan sólo el 50% debería ser portador de la mutación, por lo que los efectos de la enfermedad quedan diluidos entre un 50% de no portadores. Aun así, en otros estudios se ha recurrido a un modo similar de ampliación de la muestra. Kotze et al22 realizan un cribado de la mutación apo B 3500 en sujetos hiperlipémicos tipo IIa y IIb, reclutando a 21 familiares de primer y segundo grado, y concluyendo que, comparados con HF, los valores de colesterol pueden ser menores en BDF. Las diferencias encontradas entre las dos entidades parecen depender en cierto modo de la edad. Así, Tybjaerg-Hansen y Humphries23 construyen curvas de frecuencia acumulada de enfermedad coronaria por edades en BDF y HF, encontrando que el riesgo de enfermedad coronaria no diverge entre ambos hasta la edad de 60 años, tanto en varones como en mujeres. Algo más parecidos a los resultados de nuestro estudio son los de Maher et al, en Inglaterra, que comparan la expresión clínica y la angiografía coronaria de un grupo de BDF con otro de HF, encontrando que los pacientes con BDF desarrollan síntomas de enfermedad coronaria más tarde (50,3 ± 8,8 frente a 44,9 ± 11 años)24. Esta edad de presentación y la diferencia entre HF y BDF es muy semejante a la observada en el presente estudio (45,3 años en el grupo HF y 51,5 años en el grupo BDF) y a la de otros autores en distintos países21,24.

La HF puede variar según la mutación del r-LDL sea de tipo receptor defectuoso o de tipo no funcionante. Un estudio realizado en Bélgica comparó a pacientes con BDF y ambos tipos de mutaciones de HF, encontró similitud en los valores de colesterol total y LDL de BDF y HF del primer tipo, ambos menores que los de los HF del segundo tipo22.

La incidencia de enfermedad coronaria se encuentra determinada, en gran medida, por la extensión y la duración de la elevación del colesterol, incluso en presencia de coronarias angiográficamente normales. La reducción de las concentraciones lipídicas mejora la disfunción endotelial25, por lo que una menor concentración de cLDL podría explicar un menor riesgo cardiovascular, aunque no puede descartarse el papel de diferencias cualitativas en las LDL24,26.

Se ha sugerido que este fenotipo más suave resultaría de cambios compensatorios que conducirían a un aumento de la captación de los remanentes de lipoproteínas de muy baja densidad (VLDL) a través del receptor de las LDL, pero mediada por apo E27,28. Podría existir una regulación al alza de la actividad del r-LDL, especialmente en los sujetos más jóvenes con BDF29. Estos mecanismos dependerían de la edad, de modo que los BDF de mayor edad perderían la capacidad de compensar. Estas hipótesis estarían reforzadas por el hecho de que los homocigotos con BDF retienen un 20% de capacidad de unión normal de las LDL28. Esta capacidad de unión tiene lugar en la subfracción de partículas de baja densidad, grandes, debido a la apo E asociada a estas partículas. Estos mecanismos no tendrían lugar en los sujetos HF, que carecen de receptor LDL activo.

Al considerar los resultados de nuestro estudio en el contexto de la bibliografía internacional ya citada, éstos apuntan a que el diagnóstico genético de las hipercolesterolemias, al identificar defectos genéticos de distinta gravedad, aporta un elemento a tener en cuenta a la hora de considerar el riesgo de episodio vascular del paciente, lo que puede ser de utilidad en su manejo.

CONCLUSIONES

Aunque los sujetos con HF y con BDF resultan, a nivel individual, clínicamente indistinguibles, requiriendo para ello del análisis genético, existen diferencias entre estas dos entidades en cuanto a valores lipídicos y edad de presentación de los episodios vasculares, y es el fenotipo es más benigno en los BDF, especialmente antes de los 70 años.

Nuestros resultados apoyan la idea de que el análisis genético causal de la hipercolesterolemia puede ayudar a estratificar el riesgo en los sujetos con estas formas hereditarias de hipercolesterolemia.

AGRADECIMIENTO

Deseamos expresar nuestro agradecimiento a la Fundación para el Estudio de la Hipercolesterolemia Familiar por el acceso a los datos clínicos. Agradecemos su colaboración a los profesionales de las 69 unidades clínicas, sin la cual habría sido imposible reunir los datos de todos estos pacientes. Asimismo, agradecemos a los pacientes y sus familias la buena disposición mostrada hacia el proyecto de la Fundación para el Estudio de la Hipercolesterolemia Familiar.


Correspondencia: Dr. I. García-Álvarez García.

Laboratorio de Investigación Molecular. Hospital Universitario Miguel Servet.

Avda. Isabel la Católica, 1-3. 50009 Zaragoza. España.

Correo electrónico: garalgar@excite.com

Bibliografía
[1]
Carmena R, Real JT, Ascaso JF..
e hipercolesterolemia poligénica. En: Carmena R, Ordovás JM, editores. Hiperlipemias: clínica y tratamiento. Barcelona: Ediciones Doyma S.A..
e hipercolesterolemia poligénica. En: Carmena R, Ordovás JM, editores. Hiperlipemias: clínica y tratamiento. Barcelona: Ediciones Doyma S.A., (1999), pp. 85-97
[2]
Müller C..
Xanthomata, hypercholesterolemia and angina pectoris..
Acta Med Scand, 89 (1938), pp. 75-84
[3]
Kachadurian AK..
The inheritance of essential familial hypercholesterolemia..
Am J Med, 37 (1964), pp. 402-7
[4]
Brown MS, Goldstein JL..
Analysis of a mutant strain of human fibroblasts with a defect in the internalization of receptor bound low density lipoprotein..
Cell, 9 (1976), pp. 663-74
[5]
Russell DW, Yamamoto T, Schneider WJ, Slauther CJ, Brown MS, Goldstein JL..
c-DNA cloning of the bovine low density lipoprotein receptor: feedback regulation of a receptor mRNA..
Proc Natl Acad Sci USA, 80 (1983), pp. 7501-5
[6]
Goldstein JL, Hobbs HH, Brown MS..
Familial hypercholesterolaemia. En: Scriver CT, Beaudet AL, Sly WS, Valle D, editors. The metabolic and molecular bases of inherited disease. New York: McGraw Hill.
Familial hypercholesterolaemia. En: Scriver CT, Beaudet AL, Sly WS, Valle D, editors. The metabolic and molecular bases of inherited disease. New York: McGraw Hill, (1995), pp. 1981-2030
[7]
Soria LF, Ludwig EH, Clarke HR, Vega GL, Grundy SM, Mc Carthy BJ..
Association between a specific apoprotein B mutation and familial defective apo B 100. Proc..
Natl Acad Sci USA, 86 (1989), pp. 587-91
[8]
Rauh G, Keller C, Schuster H, Wolfgram G, Zöllner N..
Familial defective apolipoprotein B-100: a common cause of primary hyperlipemia..
Clin Invest, 70 (1992), pp. 77-8
[9]
Miserez AR, Laager R, Chiodetti N, Keller U..
High prevalence of familial defective apolipoprotein B-100 in Switzerland..
J Lipid Res, 35 (1994), pp. 574-83
[10]
Real JT, Chaves JF, Ascaso JF, Armengod ME, Carmena R..
Estudio del defecto familiar de la apo B-100 en sujetos con el diagnóstico clínico de hipercolesterolemia primaria: identificación de la primera familia afectada en España..
Med Clin (Barc), 113 (1999), pp. 15-7
[11]
Castillo S, Tejedor D, Mozas P, Reyes G, Civeira F, Alonso R, et al..
The apolipoprotein B R3500Q gene mutation in spanish subjects with a clinical diagnosis of familial hypercholesterolemia..
Atherosclerosis, 165 (2002), pp. 127-35
[12]
Miserez AR, Keller U..
Differences in phenotypic characteristics of subjects with familial defective apolipoprotein B-100 and familial hypercholesterolemia..
Arterioscler Thromb Vasc Biol, 15 (1995), pp. 1719-29
[13]
Hansen PS, Defesche JC, Kastelein JJ.P, Gerdes LU, Fraza L, Gerdes C, et al..
Phenotypic variation in patients heterozygous for Familial Defective Apolipoprotein B (FDB) in three european countries..
Arterioscler Thromb Vasc Biol, 17 (1997), pp. 741-7
[14]
Geneve: World Health Organisation, 1998.
[15]
Alonso R, Castillo S, Civeira F, Puzo J, La Cruz JJ, Pocovi M, et al..
Heterozygous familial hypercholesterolemia in Spain. Description of 819 non related cases..
Med Clin (Barc), 118 (2002), pp. 487-92
[16]
Mata P, Alonso R, Castillo S, Pocovi M..
MEDPED and the Spanish familial hypercholesterolemia foundation..
Atherosclerosis, 2 (2002), pp. 9-11
[17]
Garcés C, Rodríguez Artalejo F, Serrano A, González Bonillo J, Almagro F, Garrido JA, et al..
Manifestaciones clínicas de la hipercolesterolemia familiar heterocigota en España. Estudio de 301 casos de las áreas central y norte..
Med Clin (Barc), 114 (2000), pp. 50-1
[18]
Myant NB..
Familial defective apolipoprotein B-100: a review, including some comparisons with familial hypercholesterolaemia..
Atherosclerosis, 104 (1993), pp. 1-18
[19]
Brousseau T, Arveiler D, Cambou JP, Evans AE, Luc G, Fruchart JC, et al..
Familial defective apolipoprotein B-100 and myocardial infarction. The ECTIM study. Etude Cas-Temoins de l'Infarctus du Myocarde..
Atherosclerosis, 116 (1995), pp. 269-71
[20]
Ceska R, Vrablik M, Horinek A..
Familial defective apolipoprotein B-100: a lesson from homozygous and heterozygous patients..
Physiol Res, 49 (2000), pp. 125-30
[21]
Kalina A, Csaszar A, Czeizel AE, Romics L, Szaboki F, Szalai C, et al..
Frequency of the R3500Q mutation of the apolipoprotein B-100 gene in a sample screened clinically for familial hypercholesterolemia in Hungary..
Atherosclerosis, 154 (2001), pp. 247-51
[22]
Kotze MJ, Peeters AV, Langenhoven E, Wauters JG, Van Gaal LF..
Phenotypic expression and frequency of familial defective apolipoprotein B-100 in Belgian hypercholesterolemics..
Atherosclerosis, 111 (1994), pp. 217-25
[23]
Tybjaerg-Hansen A, Humphries SE..
Familial defective apolipoprotein B-100: a single mutation that causes hypercholesterolemia and premature coronary disease..
Atherosclerosis, 96 (1992), pp. 91-107
[24]
Maher VM, Gallagher JJ, Thompson GR, Myant NB..
Does the presence of the 3500 mutant apolipoprotein B-100 in low density lipoprotein particles affect their atherogenicity?.
Atherosclerosis, 118 (1995), pp. 105-10
[25]
Iràculis E, Cequier A, Sabaté M, Pintó X, Gómez-Hospital JA, Mauri J, et al..
Mejoría de la función endotelial al reducir las concentraciones lipídicas en pacientes con hipercolesterolemia y arterias coronarias normales..
Rev Esp Cardiol, 54 (2001), pp. 685-92
[26]
Stalenhoef AF, Defesche JC, Kleinveld HA, Demacker PN, Kastelein JJ..
Decreased resistance against in vitro oxidation of LDL from patients with familial defective apolipoprotein B-100..
Arterioscler Thromb, 14 (1994), pp. 489-93
[27]
Defesche CJ, Pricker LK, Hayden RM, van der Ende EB, Kastelein PJJ..
Familial defective apolipoprotein B-100 is clinically indistinguishable from familial hypercholesterolemia..
Arch Intern Med, 153 (1993), pp. 2349-56
[28]
Marz W, Baumstark MW, Schnarnagl H, Ruzicka V, Buxbaum S, Herwig J, et al..
Accumulation of «small dense» low density lipoprotein (LDL) in a homozygous patient with familial defective apolipoprotein B-100 results from heterogeneous interaction of LDL subfractions with the LDL receptor..
J Clin Invest, 92 (1993), pp. 2922-33
[29]
Pimstone SN, Defesche JC, Clee SM, Bakker HD, Hayden MR, Kastelein JJP..
Differences in the phenotype between children with familial defective apolipoprotein B-100 and familial hypercholesterolemia..
Arterioscler Thromb Vasc Biol, 17 (1997), pp. 826-33
Idiomas
Revista Española de Cardiología

Suscríbase a la newsletter

Opciones de artículo
Herramientas
es en

¿Es usted profesional sanitario apto para prescribir o dispensar medicamentos?

Are you a health professional able to prescribe or dispense drugs?

es en
Política de cookies Cookies policy
Utilizamos cookies propias y de terceros para mejorar nuestros servicios y mostrarle publicidad relacionada con sus preferencias mediante el análisis de sus hábitos de navegación. Si continua navegando, consideramos que acepta su uso. Puede cambiar la configuración u obtener más información aquí. To improve our services and products, we use "cookies" (own or third parties authorized) to show advertising related to client preferences through the analyses of navigation customer behavior. Continuing navigation will be considered as acceptance of this use. You can change the settings or obtain more information by clicking here.